Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311293

Morpholino Name: fzd2 MO3
Synonyms: TNeu059i07, Xtfrizzled2.2, frizzled2
Target mRNA: fzd2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGCTGTTCTGAGAGCCAAATCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTGATTTGGCTCTCAGAACAGCAGC 3' ||||||||||||||||||||||||| 3' AACTAAACCGAGAGTCTTGTCGTCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:95385156..95385180 21/25 Sense off-target ephx4.L
chr4L:95385156..95385180 21/25 Antisense off-target Xelaev18023338m
chr9_10S:19072640..19072664 21/25 unknown
chr3L:75736424..75736448 21/25 unknown
tropicalis 10.0 Chr10:14870252..14870276 25/25 Antisense target fzd2
Chr4:56816494..56816518 21/25 Antisense off-target cdh11
Chr8:70856952..70856976 21/25 Sense off-target mark4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers