Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311295

Morpholino Name: fzd6 MO2
Synonyms: TGas087l14, Xtfrizzled6.2, frizzled6
Target mRNA: fzd6

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGCAGATGCTCTGTTCATGGAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTTCCATGAACAGAGCATCTGCTGT 3' ||||||||||||||||||||||||| 3' GAAGGTACTTGTCTCGTAGACGACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:12893659..12893683 22/25 Sense off-target adarb2.S
chr3L:57654245..57654269 21/25 Antisense off-target immp2l.L
chr6L:15763027..15763051 21/25 Sense off-target adarb2.L
tropicalis 10.0 Chr6:131639056..131639080 25/25 Antisense target fzd6
Chr6:19474839..19474863 21/25 Sense off-target adarb2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers