Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311299

Morpholino Name: fzd8 MO5
Synonyms: TNeu087g20, Xtfrizzled8.2, frizzled8
Target mRNA: fzd8

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCATCCCCTCAACTCCTCAACTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:190572233..190572257 21/25 unknown
tropicalis 10.0 Chr3:21346540..21346564 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers