Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311301

Morpholino Name: fzd10 MO3
Synonyms: TGas025k08, Xtfrizzled9/10a.2, frizzled10
Target mRNA: fzd10

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGCTGATAGCGAATGACTGGAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCTCCAGTCATTCGCTATCAGCCCG 3' ||||||||||||||||||||||||| 3' CGAGGTCAGTAAGCGATAGTCGGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:72372556..72372580 21/25 unknown
chr7L:47497306..47497330 21/25 unknown
tropicalis 10.0 Chr1:158184879..158184903 25/25 Antisense target fzd10
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers