Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311302

Morpholino Name: sfrp1 MO4
Synonyms: Frza, TNeu102i09, XtFrzA
Target mRNA: sfrp1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCCCCACAGAAATAAACTTCACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTGAAGTTTATTTCTGTGGGGAGA 3' ||||||||||||||||||||||||| 3' TCACTTCAAATAAAGACACCCCTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:121765403..121765427 21/25 Sense off-target slc18a1.L
chr3L:121765403..121765427 21/25 Sense off-target slc18a2.L
chr4S:7818866..7818890 21/25 Antisense off-target LOC108715207 [provisional:brsk2]
chr3S:112955987..112956011 21/25 unknown
chr9_10L:11289628..11289652 21/25 unknown
tropicalis 10.0 Chr3:127008199..127008223 25/25 Antisense target sfrp1
Chr3:60406399..60406423 21/25 Antisense off-target trhde
Chr7:62108256..62108280 21/25 Antisense off-target wdfy4
Chr3:49260237..49260261 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers