Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311304

Morpholino Name: hbegf MO1
Synonyms: TEgg038n05, XtFullback
Target mRNA: hbegf

Morpholino Type: uncategorized morpholino
Sequence: 5' TGAAGTTCATGTTCAGTTAGGAGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TTCTCCTAACTGAACATGAACTTCA 3' ||||||||||||||||||||||||| 3' AAGAGGATTGACTTGTACTTGAAGT 5' 5' GTCTCTTAACTCAACATGAACTTCA 3' |||| ||||| ||||||||||||| 3' AAGAGGATTGACTTGTACTTGAAGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:24849453..24849477 22/25 Antisense target hbegf.L
chr1S:157369324..157369348 21/25 unknown
tropicalis 10.0 Chr3:31765346..31765370 25/25 Antisense target hbegf
Chr1:170289829..170289853 21/25 Antisense off-target LOC105948047
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers