Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311307

Morpholino Name: hoxc8 MO1
Synonyms: TNeu108m10, XtHoxC8
Target mRNA: hoxc8

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTCATGGTTCTTGCATGTAAGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GCCTTACATGCAAGAACCATGAGCT 3' ||||||||||||||||||||||||| 3' CGGAATGTACGTTCTTGGTACTCGA 5' 5' GCCTTACATGCAAGAACCATGAGCT 3' ||||||||||||||||||||||||| 3' CGGAATGTACGTTCTTGGTACTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:128767002..128767026 25/25 Antisense target hoxc8.S
chr2L:148315291..148315315 25/25 Antisense off-target xhoxc8
tropicalis 10.0 Chr2:146089088..146089112 25/25 Antisense target hoxc8
Chr3:48544503..48544527 21/25 Antisense off-target LOC101734576
Chr3:48544503..48544527 21/25 Sense off-target LOC105947391
Chr3:52825126..52825150 21/25 Antisense off-target ppfia2
Chr1:120971787..120971811 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers