Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311309

Morpholino Name: cbx1 MO1
Synonyms: HP1beta-MO, TEgg130i17, XtHP1b
Target mRNA: cbx1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTCTTGTTCTGCTTCTTTCCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CATGGGAAAGAAGCAGAACAAGAAA 3' ||||||||||||||||||||||||| 3' GTACCCTTTCTTCGTCTTGTTCTTT 5' 5' CATGGGAAAGAAGCAGAACAAGAAA 3' ||||||||||||||||||||||||| 3' GTACCCTTTCTTCGTCTTGTTCTTT 5' 5' CATGGGAAAGAAGCAGAACAAGAAA 3' ||||||||||||||||||||||||| 3' GTACCCTTTCTTCGTCTTGTTCTTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:3257181..3257205 25/25 Antisense target cbx1.L
chr9_10S:2885238..2885262 25/25 Antisense target cbx1.S
Scaffold72:757168..757192 21/25 Antisense off-target phc2.L
chr3L:81024557..81024581 21/25 Antisense off-target nmb.L
chr3L:9364032..9364056 21/25 Sense off-target LOC108710190 [provisional:bdp1]
chr6S:11971763..11971787 21/25 Sense off-target LOC108719828
chr9_10L:36486634..36486658 22/25 unknown
Scaffold30:2614554..2614578 21/25 unknown
chr1S:158154982..158155006 21/25 unknown
chr2L:177414971..177414995 21/25 unknown
chr5S:52062870..52062894 21/25 unknown
chr6L:79728572..79728596 21/25 unknown
chr7L:81489624..81489648 21/25 unknown
chr8L:43564623..43564647 21/25 unknown
chr9_10L:26568440..26568464 21/25 unknown
tropicalis 10.0 Chr10:11722533..11722557 25/25 Antisense target cbx1
Chr2:126989181..126989205 21/25 Sense off-target klf12
Chr2:126989181..126989205 21/25 Antisense off-target LOC105946545
Chr2:89363726..89363750 21/25 Antisense off-target luzp1
Chr5:64839690..64839714 21/25 Sense off-target aig1
Chr6:116864907..116864931 21/25 Antisense off-target ca8
Chr7:1527557..1527581 21/25 Antisense off-target sorcs1
Chr8:134205151..134205175 21/25 Antisense off-target LOC100495225
Chr1:46506299..46506323 21/25 unknown
Chr6:87051648..87051672 21/25 unknown
Chr7:32118265..32118289 21/25 unknown
Chr8:122526138..122526162 21/25 unknown
Chr8:134280003..134280027 21/25 unknown
Chr8:134330159..134330183 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Heterochromatin protein 1 beta regulates neural and neural crest development by repressing pluripotency-associated gene pou5f3.2/oct25 in Xenopus., Dev Dyn 2021  
View All Papers