Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311310

Morpholino Name: dnali1 MO1
Synonyms: TNeu100n17, Xthp28aDLC
Target mRNA: dnali1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCATGTTGAGCGATTCACAGATAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' ATATCTGTGAATCGCTCAACATGAT 3' ||||||||||||||||||||||||| 3' TATAGACACTTAGCGAGTTGTACTA 5' 5' ACACCTGTGCTTCGCTCAACATGAT 3' | | ||||| |||||||||||||| 3' TATAGACACTTAGCGAGTTGTACTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:68940006..68940030 21/25 Antisense target dnali1.S
chr5L:98153601..98153625 21/25 Sense off-target dvl3.L
chr5S:82182101..82182125 21/25 Sense off-target LOC108718034 [provisional:dvl3]
chr9_10S:30727966..30727990 21/25 Sense off-target LOC100489773-like.S
chr9_10S:30727966..30727990 21/25 Sense off-target LOC108702768 [provisional:asap2]
chr6S:9889344..9889368 21/25 unknown
tropicalis 10.0 Chr2:84678976..84679000 25/25 Antisense target dnali1
Chr2:84678976..84679000 25/25 Sense off-target cdca8
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers