Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311311

Morpholino Name: ing3 MO1
Synonyms: TNeu023p18, XtIng3-prov
Target mRNA: ing3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGATAATCCTCCAGGTACAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' ATGTTGTACCTGGAGGATTATCTGG 3' ||||||||||||||||||||||||| 3' TACAACATGGACCTCCTAATAGACC 5' 5' ATGCTGTACTTGGAGGATTATCTGG 3' ||| ||||| ||||||||||||||| 3' TACAACATGGACCTCCTAATAGACC 5' 5' ATGCTGTACTTGGAGGATTATCTGG 3' ||| ||||| ||||||||||||||| 3' TACAACATGGACCTCCTAATAGACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:60651635..60651659 23/25 Antisense target ing3.L
chr3S:77655020..77655044 23/25 Antisense target ing3.S
chr6L:87528287..87528311 21/25 Antisense off-target LOC108719126 [provisional:col21a1]
chr7S:76286277..76286301 21/25 Antisense off-target bcam.S
chr5S:59258524..59258548 21/25 unknown
tropicalis 10.0 Chr3:69341668..69341692 25/25 Antisense target ing3
Chr3:69341668..69341692 25/25 Sense off-target tspan12
Chr3:14567409..14567433 21/25 Antisense off-target prmt8
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers