Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311312

Morpholino Name: ing5 MO1
Synonyms: TGas087m13, XtING5
Target mRNA: ing5

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCTAGGTACATCGCCGTCGCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' CATGGCGACGGCGATGTACCTAGAG 3' ||||||||||||||||||||||||| 3' GTACCGCTGCCGCTACATGGATCTC 5' 5' CATGGCGACGGCGATGTACCTAGAG 3' ||||||||||||||||||||||||| 3' GTACCGCTGCCGCTACATGGATCTC 5' 5' CATGGCGACGGCGATGTACCTAGAA 3' |||||||||||||||||||||||| 3' GTACCGCTGCCGCTACATGGATCTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:123890004..123890028 25/25 Antisense target ing5.L
chr5S:106617373..106617397 24/25 Antisense target ing5.S
tropicalis 10.0 Chr5:125720038..125720062 25/25 Antisense target ing5
Chr5:125720038..125720062 25/25 Sense off-target dtymk
Chr10:18023652..18023676 21/25 Sense off-target nags
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers