Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311314

Morpholino Name: vhl MO1
Synonyms: TEgg131f10, XtIVBCc
Target mRNA: vhl

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAAACGTCCTGCGGCATCCCGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

MO
5' CCGGGATGCCGCAGGACGTTTCC 3' ||||||||||||||||||||||| 3' GGCCCTACGGCGTCCTGCAAAGG 5' 5' CCGGGATGCCGGAAGACGTTTCC 3' ||||||||||| | ||||||||| 3' GGCCCTACGGCGTCCTGCAAAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:125923085..125923107 21/23 Antisense target vhl.L
tropicalis 10.0 Chr4:131748543..131748565 23/23 Antisense target vhl
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers