Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311315

Morpholino Name: kdm2a MO2
Synonyms: F-box and leucine-rich repeat protein 11-like, TNeu054b08, XtJEMMA
Target mRNA: kdm2a

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGTTGCTCCTCTTCCATTTCTTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GGAAGAAATGGAAGAGGAGCAACTC 3' ||||||||||||||||||||||||| 3' CCTTCTTTACCTTCTCCTCGTTGAG 5' 5' GGAAGAAATGGAAGAGGAGCAACTG 3' |||||||||||||||||||||||| 3' CCTTCTTTACCTTCTCCTCGTTGAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:55121140..55121164 24/25 Antisense target kdm2a.L
chr7S:38237129..38237153 24/25 Antisense off-target LOC108697539 [provisional:kdm2a]
chr2L:173809053..173809077 21/25 Antisense off-target trim26.L
chr4L:57841994..57842018 21/25 Antisense off-target faap24.L
chr7L:3364121..3364145 21/25 Sense off-target atrnl1.L
chr7L:98511007..98511031 21/25 Antisense off-target znf865.L
chr7S:2482251..2482275 21/25 Sense off-target LOC108697311 [provisional:atrnl1]
chr9_10L:78986058..78986082 21/25 Antisense off-target nbeal1.L
chr2L:62761242..62761266 21/25 unknown
chr5S:71439492..71439516 21/25 unknown
chr7S:78298876..78298900 21/25 unknown
chr9_10S:43401040..43401064 21/25 unknown
tropicalis 10.0 Chr7:57838229..57838253 25/25 Antisense target kdm2a
Chr8:136468090..136468114 21/25 Antisense off-target Xetrov107058366m.g
Chr8:136468090..136468114 21/25 Antisense off-target LOC101732054
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers