Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311316

Morpholino Name: heatr5b MO1
Synonyms: TEgg078i21, XtKIAA1414
Target mRNA: heatr5b

Morpholino Type: uncategorized morpholino
Sequence: 5' CAACAAGCTATGGGCCAACTCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CATGGAGTTGGCCCATAGCTTGTTG 3' ||||||||||||||||||||||||| 3' GTACCTCAACCGGGTATCGAACAAC 5' 5' CATGGAGTTGGCACACAGCTTGTTG 3' |||||||||||| || ||||||||| 3' GTACCTCAACCGGGTATCGAACAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:46087775..46087799 23/25 Antisense target heatr5b.L
chr4S:66611498..66611522 21/25 unknown
tropicalis 10.0 Chr5:46704253..46704277 25/25 Antisense target heatr5b
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers