Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311334

Morpholino Name: cers3 MO1
Synonyms: Lass2, TGas078f22, XtLag1.2
Target mRNA: cers3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAATCGCTTAGAGTCTGAAACATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' GATGTTTCAGACTCTAAGCGATTGG 3' ||||||||||||||||||||||||| 3' CTACAAAGTCTGAGATTCGCTAACC 5' 5' GATGTTTCAGACTGTAAGCGACTGG 3' ||||||||||||| ||||||| ||| 3' CTACAAAGTCTGAGATTCGCTAACC 5' 5' GATGTTTCAGACTGTAAGCGACTGG 3' ||||||||||||| ||||||| ||| 3' CTACAAAGTCTGAGATTCGCTAACC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:106452285..106452309 23/25 Antisense target cers3.L
chr3S:37494411..37494435 23/25 Antisense target cers3.S
tropicalis 10.0 Chr3:115509945..115509969 25/25 Antisense target cers3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers