Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311337

Morpholino Name: lhx1 MO2
Synonyms: Lim 1, TGas028k15, XtLim1
Target mRNA: lhx1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCGCATCCAGCACAGTGAACCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genomic

MO
5' AATGGTTCACTGTGCTGGATGCGAA 3' |||||||||||||||||||||||| 3' GTACCAAGTGACACGACCTACGCTT 5' 5' AATGGTTCACTGTGCTGGATGCGAA 3' |||||||||||||||||||||||| 3' GTACCAAGTGACACGACCTACGCTT 5' 5' AATGGTTCACTGTGCTGGATGCGAA 3' |||||||||||||||||||||||| 3' GTACCAAGTGACACGACCTACGCTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:61067242..61067266 24/25 Antisense target lhx1.L
chr2S:61240037..61240061 24/25 Antisense target lhx1.S
chr8S:61790043..61790067 21/25 unknown
tropicalis 10.0 Chr2:75675368..75675392 24/25 Antisense target lhx1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers