Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311338

Morpholino Name: ap1m2 MO1
Synonyms: Mu1a, TTbA033a09, XtM1b
Target mRNA: ap1m2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATATACACGGCGGAGGCTGACATAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 22/25
genomic

MO
5' GTATGTCAGCCTCCGCCGTGTATAT 3' ||||||||||||||||||||||||| 3' CATACAGTCGGAGGCGGCACATATA 5' 5' GTATGTCAGCCTCCGCTGTGTTTAT 3' |||||||||||||||| |||| ||| 3' CATACAGTCGGAGGCGGCACATATA 5' 5' GTATGTCAGCCTCGGCCGTCTTTAT 3' ||||||||||||| ||||| | ||| 3' CATACAGTCGGAGGCGGCACATATA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:131457147..131457171 23/25 Antisense target ap1m2.L
Scaffold20:39353..39377 22/25 Antisense target ap1m2.S
tropicalis 10.0 Chr3:138238500..138238524 25/25 Antisense target ap1m2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers