Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311339

Morpholino Name: mfge8 MO1
Synonyms: EDIL3, TNeu132f09, XtMFGE8
Target mRNA: mfge8

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCCATCCATCGTTAGCACACAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CCTGTGTGCTAACGATGGATGGATC 3' ||||||||||||||||||||||||| 3' GGACACACGATTGCTACCTACCTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7S:31130125..31130149 21/25 Antisense off-target nfkb2.S
chr8L:25183396..25183420 21/25 Antisense off-target slc16a2.L
chr5L:103988585..103988609 21/25 unknown
tropicalis 10.0 Chr3:109703251..109703275 25/25 Antisense target mfge8
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers