Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311340

Morpholino Name: suv420h2 MO3
Synonyms: TNeu059e17, XtMGC2705
Target mRNA: kmt5c

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCGTCAAGCGATTTGAACCCATAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CTATGGGTTCAAATCGCTTGACGGC 3' ||||||||||||||||||||||||| 3' GATACCCAAGTTTAGCGAACTGCCG 5' 5' CTATGGGTTCAAATCGGTTGACGGC 3' |||||||||||||||| |||||||| 3' GATACCCAAGTTTAGCGAACTGCCG 5' 5' CTATGGGTTCAAATCGGTTGACGGC 3' |||||||||||||||| |||||||| 3' GATACCCAAGTTTAGCGAACTGCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:109610513..109610537 24/25 Antisense target kmt5c.L
chr7S:80966438..80966462 24/25 Antisense target kmt5c.S
tropicalis 10.0 Chr7:114223798..114223822 25/25 Antisense target kmt5c
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers