Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311341

Morpholino Name: ap2m1 MO2
Synonyms: TNeu123l16, XtMu2
Target mRNA: ap2m1

Morpholino Type: uncategorized morpholino
Sequence: 5' TATATGAACAGTCCCCCAATCATGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CCATGATTGGGGGACTGTTCATATA 3' ||||||||||||||||||||||||| 3' GGTACTAACCCCCTGACAAGTATAT 5' 5' CCATGATTGGAGGACTGTTCATATA 3' |||||||||| |||||||||||||| 3' GGTACTAACCCCCTGACAAGTATAT 5' 5' CCATGATTGGAGGACTGTTCATATA 3' |||||||||| |||||||||||||| 3' GGTACTAACCCCCTGACAAGTATAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:98173229..98173253 24/25 Antisense target ap2m1.L
chr5S:82152526..82152550 24/25 Antisense target ap2m1.S
chr9_10L:32714548..32714572 21/25 Sense off-target ahcy.L
tropicalis 10.0 Chr5:100119432..100119456 25/25 Antisense target ap2m1
Chr3:40693802..40693826 21/25 Antisense off-target Xetrov107021482m.g
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers