Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311343

Morpholino Name: nog2 MO2
Synonyms: TNeu122a14, Xtnoggin2, noggin2
Target mRNA: nog2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCAGGCAGATTTATCCTCTTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' CATGAAGAGGATAAATCTGCCTGAG 3' ||||||||||||||||||||||||| 3' GTACTTCTCCTATTTAGACGGACTC 5' 5' CATGAAGAGGATAAATCTGCCTGAG 3' ||||||||||||||||||||||||| 3' GTACTTCTCCTATTTAGACGGACTC 5' 5' CATGAAGAGGATAAATCTGCCTGAG 3' ||||||||||||||||||||||||| 3' GTACTTCTCCTATTTAGACGGACTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:104428457..104428481 25/25 Antisense target nog2.L
chr9_10S:93069012..93069036 25/25 Antisense target nog2.S
chr4L:41652095..41652119 21/25 Sense off-target LOC108714022 [provisional:gnao1]
chr5S:47785575..47785599 21/25 Sense off-target Xetrov90013913m.S
chr8L:10761079..10761103 22/25 unknown
chr3L:56494287..56494311 21/25 unknown
chr6L:119909353..119909377 21/25 unknown
tropicalis 10.0 Chr9:22060897..22060921 25/25 Antisense target nog2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers