Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311344

Morpholino Name: timm29 MO1
Synonyms: TGas128o11, c19orf52 MO1, xtnovel1
Target mRNA: timm29

Morpholino Type: uncategorized morpholino
Sequence: 5' CGACCCCAATCCACCGTGCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGGCAGCACGGTGGATTGGGGTCG 3' ||||||||||||||||||||||||| 3' TACCGTCGTGCCACCTAACCCCAGC 5' 5' ATGGCAGCGCGCTGGATTGGGGTCG 3' |||||||| || ||||||||||||| 3' TACCGTCGTGCCACCTAACCCCAGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold20:532954..532978 23/25 Antisense target timm29.S
chr6L:29225386..29225410 21/25 Sense off-target pex1.L
tropicalis 10.0 Chr3:138885166..138885190 25/25 Antisense target timm29
Chr3:138885166..138885190 25/25 Sense off-target yipf2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers