Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311345

Morpholino Name: timm29 MO2
Synonyms: TGas128o11, c19orf52 MO2, xtnovel1.2
Target mRNA: timm29

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCCTTCCGCCAGCTCTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20 19/20
genomic

MO
5' TGCAGAGCTGGCGGAAGGCG 3' |||||||||||||||||||| 3' ACGTCTCGACCGCCTTCCGC 5' 5' TGCAGAGCTGGCGGAAGACG 3' ||||||||||||||||| || 3' ACGTCTCGACCGCCTTCCGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold20:532934..532953 19/20 Antisense target timm29.S
chr4S:77382138..77382157 18/20 Antisense off-target fnbp1l.S
chr9_10S:96214719..96214738 18/20 Sense off-target LOC108703212 [provisional:rab26]
chr7L:7762987..7763006 16/20 Sense off-target znf384.L
chr7S:4869562..4869581 16/20 Sense off-target MGC78849
chr7S:4874083..4874102 16/20 Sense off-target MGC78849
chr7S:4877269..4877288 16/20 Sense off-target MGC78849
Scaffold105697:10..29 16/20 unknown
tropicalis 10.0 Chr3:138885146..138885165 20/20 Antisense target timm29
Chr3:138885146..138885165 20/20 Sense off-target yipf2
Chr7:47463203..47463222 16/20 Sense off-target pcbd1
Chr7:9945788..9945807 16/20 Sense off-target znf384
Chr7:9949624..9949643 16/20 Sense off-target znf384
Chr7:9951672..9951691 16/20 Sense off-target znf384
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers