Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311351

Morpholino Name: tcaf1 MO1
Synonyms: TGas053p21, Xtnovel13, fam115a
Target mRNA: tcaf1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTTGTAATCTTCAAAAAGCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAGCTTTTTGAAGATTACAAAG 3' ||||||||||||||||||||||||| 3' TACCTCGAAAAACTTCTAATGTTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:80377747..80377771 22/25 Antisense off-target fam115a-like.L
Scaffold45:1455024..1455048 21/25 Antisense off-target c11orf65.L
chr1L:30880002..30880026 21/25 Sense off-target corin.L
chr3L:72762904..72762928 21/25 Antisense off-target LOC108711222 [provisional:cdc123]
chr5L:74602526..74602550 21/25 Antisense off-target asf1a.L
chr2S:64317292..64317316 22/25 unknown
tropicalis 10.0 Chr3:89965464..89965488 25/25 Antisense target tcaf1
Chr2:178472608..178472632 21/25 Sense off-target LOC116408625
Chr10:27109275..27109299 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers