Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311362

Morpholino Name: loc100489386 MO1
Synonyms: TGas080g08, Xtnovel14
Target mRNA: XB5884357 [provisional]

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCTGTGGGTTCCTGTCAGTCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:105955802..105955826 21/25 Sense off-target dmd.1.L
chr2L:1561150..1561174 21/25 Sense off-target tbx15.L
chr6S:127211944..127211968 21/25 Antisense off-target loc100489386.S
chr5L:108296679..108296703 21/25 unknown
tropicalis 10.0 Chr6:152457636..152457660 25/25 Antisense off-target LOC100489386
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers