Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311363

Morpholino Name: loc100489386 MO2
Synonyms: TGas080g08, Xtnovel14.2
Target mRNA: XB5884357 [provisional]

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGGGATTCCTGTACGGAAAAAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr6:152457593..152457617 25/25 Antisense off-target LOC100489386
Chr6:20674200..20674224 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers