Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311365

Morpholino Name: ccdc174 MO1
Synonyms: TGas055a16, Xtnovel 16
Target mRNA: ccdc174

Morpholino Type: uncategorized morpholino
Sequence: 5' CTAGCGGCTTCTTCTTCCTGTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGGACAGGAAGAAGAAGCCGCTAG 3' ||||||||||||||||||||||||| 3' TACCTGTCCTTCTTCTTCGGCGATC 5' 5' ATGGACAGGAAGAAGAAGCTGCTGG 3' ||||||||||||||||||| ||| | 3' TACCTGTCCTTCTTCTTCGGCGATC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:105217322..105217346 23/25 Antisense target ccdc174.S
chr5L:107650984..107651008 21/25 Sense off-target fndc3b.L
chr9_10S:37148710..37148734 21/25 Antisense off-target LOC108702224 [provisional:b3gntl1]
tropicalis 10.0 Chr4:132538953..132538977 25/25 Antisense target ccdc174
Chr4:148571734..148571758 21/25 Sense off-target dnah12
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers