Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311368

Morpholino Name: fam214a MO2
Synonyms: TGas096p02, Xtnovel18.2
Target mRNA: fam214a

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCTCTGGCAGGAAGCACTCACAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' CTGTGAGTGCTTCCTGCCAGAGAAG 3' ||||||||||||||||||||||||| 3' GACACTCACGAAGGACGGTCTCTTC 5' 5' CTGTGAGAGCTTCCTGCCAGAGAAG 3' ||||||| ||||||||||||||||| 3' GACACTCACGAAGGACGGTCTCTTC 5' 5' CTGTGAGAGTTTCCTGCCAGAGAAG 3' ||||||| | ||||||||||||||| 3' GACACTCACGAAGGACGGTCTCTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:91850323..91850347 24/25 Antisense target fam214a.L
chr3S:51093064..51093088 23/25 Antisense target fam214a.S
chr1S:3551140..3551164 21/25 unknown
chr8S:69058131..69058155 21/25 unknown
tropicalis 10.0 Chr3:101829118..101829142 25/25 Antisense target fam214a
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers