Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311370

Morpholino Name: trmt61a
Synonyms: TGas076l13, Xtnovel2
Target mRNA: trmt61a

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCATGCTGTTATATTCTGCTGTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAACAGCAGAATATAACAGCATGAG 3' ||||||||||||||||||||||||| 3' CTTGTCGTCTTATATTGTCGTACTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:20620277..20620301 22/25 Sense off-target nav2.S
chr5S:37703313..37703337 21/25 unknown
chr6L:148961338..148961362 21/25 unknown
tropicalis 10.0 Chr8:98375477..98375501 25/25 Antisense target trmt61a
Chr4:95536216..95536240 21/25 Sense off-target agbl4
Chr5:46777080..46777104 21/25 Antisense off-target rasgrp3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers