Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311371

Morpholino Name: ap5s1 MO1
Synonyms: Sex comb on midleg homolog 1, TGas118b19, Xtnovel20
Target mRNA: ap5s1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTGAATAACAAAGCCATAAACCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGTTTATGGCTTTGTTATTCACA 3' ||||||||||||||||||||||||| 3' TACCAAATACCGAAACAATAAGTGT 5' 5' ATGGTTTATGGCTTTGTTATTCACA 3' ||||||||||||||||||||||||| 3' TACCAAATACCGAAACAATAAGTGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:57739948..57739972 25/25 Antisense target ap5s1.L
chr7L:57739948..57739972 25/25 Antisense off-target ctnnbip1.L
chr3L:137561869..137561893 22/25 Antisense off-target LOC108710418 [provisional:casr]
chr8S:98317286..98317310 22/25 Sense off-target efna3.S
chr1S:53383540..53383564 21/25 Antisense off-target fat4.S
chr1S:7274940..7274964 21/25 Antisense off-target LOC108706501 [provisional:ctnna2]
chr3L:85123305..85123329 21/25 Antisense off-target Xelaev18018096m
chr3S:47882280..47882304 21/25 Antisense off-target fsd2.S
chr6S:28709108..28709132 21/25 Antisense off-target dgkb.S
chr7L:33165609..33165633 21/25 Antisense off-target LOC108696198
chr7S:82615370..82615394 21/25 Antisense off-target prkcg.S
chr4L:100613454..100613478 21/25 unknown
chr5S:29122458..29122482 21/25 unknown
chr6L:78077683..78077707 21/25 unknown
tropicalis 10.0 Chr7:63492427..63492451 25/25 Antisense target ap5s1
Chr1:180626719..180626743 21/25 Antisense off-target edil3
Chr3:78135098..78135122 21/25 Antisense off-target ccdc146
Chr6:30609646..30609670 21/25 unknown
Chr8:4166132..4166156 21/25 unknown
Chr8:92429748..92429772 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers