Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311390

Morpholino Name: otogl2 MO1
Synonyms: TNeu069g20, Xtnovel23.2, otog MO3
Target mRNA: otogl2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTCTAGCCACAGTGGAACCACACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GGTGTGGTTCCACTGTGGCTAGAAC 3' ||||||||||||||||||||||||| 3' CCACACCAAGGTGACACCGATCTTG 5' 5' GCTGTGGTTCCACTTTGGCTAAAAC 3' | |||||||||||| |||||| ||| 3' CCACACCAAGGTGACACCGATCTTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:108329521..108329545 22/25 Antisense target otogl2.L
tropicalis 10.0 Chr7:112983618..112983642 25/25 Antisense target otogl2
Chr7:112983618..112983642 25/25 Antisense off-target Xetrov107050600m.g
Chr7:112983618..112983642 25/25 Antisense off-target pih1d1
Chr7:57088845..57088869 21/25 Antisense off-target osbp
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers