Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311392

Morpholino Name: ugt3a2
Synonyms: TNeu051m09, Xtnovel25, glucuronosyltransferase
Target mRNA: ugt3a2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCAGGGAATGGAACCAAGCGTCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CTGACACTTGGTTCCATTCCCTGGA 3' ||||| ||||||||||||||||||| 3' GACTGCGAACCAAGGTAAGGGACCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr1:198246425..198246449 24/25 Antisense target ugt3a2
Chr1:198265683..198265707 25/25 Antisense off-target LOC100488176
Chr1:198246425..198246449 24/25 Antisense off-target LOC100488176
Chr8:44367099..44367123 21/25 Antisense off-target Xetrov107053917m.g
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers