Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311393

Morpholino Name: aurkaip1 MO1
Synonyms: TNeu087h08, Xtnovel26
Target mRNA: aurkaip1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTAGCCGTGTAAGCCACATGGTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 22/25
genomic

MO
5' TGCACCATGTGGCTTACACGGCTAG 3' ||||||||||||||||||||||||| 3' ACGTGGTACACCGAATGTGCCGATC 5' 5' TCCACTATGTGGCTTACACGGCTAA 3' | ||| |||||||||||||||||| 3' ACGTGGTACACCGAATGTGCCGATC 5' 5' TCCAGCATGTGGCTTACACGGCTAA 3' | || ||||||||||||||||||| 3' ACGTGGTACACCGAATGTGCCGATC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:86885476..86885500 22/25 Antisense target aurkaip1.L
chr7S:61965931..61965955 22/25 Antisense target aurkaip1.S
tropicalis 10.0 Chr7:92979742..92979766 25/25 Antisense target aurkaip1
Chr5:131672779..131672803 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers