Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311395

Morpholino Name: tmem70 MO1
Synonyms: TNeu097d01, Xtnovel28
Target mRNA: tmem70

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGCTCCTCAGGCTCACTCACACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGTGTGAGTGAGCCTGAGGAGCCCG 3' ||||||||||||||||||||||||| 3' ACACACTCACTCGGACTCCTCGGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:7906312..7906336 21/25 Sense off-target acvr2b.S
chr5S:8654774..8654798 22/25 unknown
chr7S:7050706..7050730 21/25 unknown
tropicalis 10.0 Chr6:121391476..121391500 25/25 Antisense target tmem70
Chr10:50543296..50543320 23/25 Antisense off-target LOC100488540
Chr10:50543585..50543609 23/25 Antisense off-target LOC100488540
Chr10:50543730..50543754 23/25 Antisense off-target LOC100488540
Chr10:50544237..50544261 23/25 Antisense off-target LOC100488540
Chr10:50544382..50544406 23/25 Antisense off-target LOC100488540
Chr10:50544780..50544804 23/25 Antisense off-target LOC100488540
Chr10:50544853..50544877 23/25 Antisense off-target LOC100488540
Chr10:50544890..50544914 23/25 Antisense off-target LOC100488540
Chr10:50545251..50545275 23/25 Antisense off-target LOC100488540
Chr10:50545288..50545312 23/25 Antisense off-target LOC100488540
Chr10:50545325..50545349 23/25 Antisense off-target LOC100488540
Chr10:50545434..50545458 23/25 Antisense off-target LOC100488540
Chr10:50543839..50543863 22/25 Antisense off-target LOC100488540
Chr10:50543948..50543972 22/25 Antisense off-target LOC100488540
Chr10:50544491..50544515 22/25 Antisense off-target LOC100488540
Chr10:50545543..50545567 22/25 Antisense off-target LOC100488540
Chr10:50543441..50543465 21/25 Antisense off-target LOC100488540
Chr10:50543477..50543501 21/25 Antisense off-target LOC100488540
Chr10:50543513..50543537 21/25 Antisense off-target LOC100488540
Chr10:50543622..50543646 21/25 Antisense off-target LOC100488540
Chr10:50543658..50543682 21/25 Antisense off-target LOC100488540
Chr10:50543767..50543791 21/25 Antisense off-target LOC100488540
Chr10:50543803..50543827 21/25 Antisense off-target LOC100488540
Chr10:50543876..50543900 21/25 Antisense off-target LOC100488540
Chr10:50543912..50543936 21/25 Antisense off-target LOC100488540
Chr10:50544093..50544117 21/25 Antisense off-target LOC100488540
Chr10:50544129..50544153 21/25 Antisense off-target LOC100488540
Chr10:50544165..50544189 21/25 Antisense off-target LOC100488540
Chr10:50544274..50544298 21/25 Antisense off-target LOC100488540
Chr10:50544310..50544334 21/25 Antisense off-target LOC100488540
Chr10:50544419..50544443 21/25 Antisense off-target LOC100488540
Chr10:50544455..50544479 21/25 Antisense off-target LOC100488540
Chr10:50544528..50544552 21/25 Antisense off-target LOC100488540
Chr10:50544564..50544588 21/25 Antisense off-target LOC100488540
Chr10:50544672..50544696 21/25 Antisense off-target LOC100488540
Chr10:50544708..50544732 21/25 Antisense off-target LOC100488540
Chr10:50544817..50544841 21/25 Antisense off-target LOC100488540
Chr10:50544927..50544951 21/25 Antisense off-target LOC100488540
Chr10:50544963..50544987 21/25 Antisense off-target LOC100488540
Chr10:50544999..50545023 21/25 Antisense off-target LOC100488540
Chr10:50545071..50545095 21/25 Antisense off-target LOC100488540
Chr10:50545107..50545131 21/25 Antisense off-target LOC100488540
Chr10:50545179..50545203 21/25 Antisense off-target LOC100488540
Chr10:50545398..50545422 21/25 Antisense off-target LOC100488540
Chr10:50545471..50545495 21/25 Antisense off-target LOC100488540
Chr10:50545507..50545531 21/25 Antisense off-target LOC100488540
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers