Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311396

Morpholino Name: tmem70 MO2
Synonyms: TNeu097d01, Xtnovel28.2
Target mRNA: tmem70

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGCAAGTTGTGAGGCGGAACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' CATGTTCCGCCTCACAACTTGCTGC 3' ||||||||||||||||||||||||| 3' GTACAAGGCGGAGTGTTGAACGACG 5' 5' GATGTTACGCTTGACAACTTGCTGC 3' ||||| ||| | |||||||||||| 3' GTACAAGGCGGAGTGTTGAACGACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr6S:98426522..98426546 21/25 Antisense target tmem70.S
chr2L:61541203..61541227 21/25 unknown
tropicalis 10.0 Chr6:121391510..121391534 25/25 Antisense target tmem70
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers