Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311397

Morpholino Name: rpap3 MO1
Synonyms: TNeu057e12, Xtnovel29
Target mRNA: rpap3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAAGACATTCTGTAGACCAGATGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' TCATCTGGTCTACAGAATGTCTTCC 3' ||||||||||||||||||||||||| 3' AGTAGACCAGATGTCTTACAGAAGG 5' 5' ACATCTGATCTACAGAATGTCTTCT 3' |||||| |||||||||||||||| 3' AGTAGACCAGATGTCTTACAGAAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:54717118..54717142 22/25 Antisense target rpap3.L
Scaffold91:300491..300515 21/25 Sense off-target LOC108705322 [provisional:ptprj]
Scaffold28:3576386..3576410 21/25 unknown
chr2L:179292926..179292950 21/25 unknown
tropicalis 10.0 Chr3:63311899..63311923 25/25 Antisense target rpap3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers