Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311398

Morpholino Name: ap5s1 MO2
Synonyms: TGas030d13, Xtnovel3
Target mRNA: ap5s1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTGAATAACAAAGCCATAAACCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGGTTTATGGCTTTGTTATTCAC 3' ||||||||||||||||||||||||| 3' CTACCAAATACCGAAACAATAAGTG 5' 5' GATGGTTTATGGCTTTGTTATTCAC 3' ||||||||||||||||||||||||| 3' CTACCAAATACCGAAACAATAAGTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:57739947..57739971 25/25 Antisense target ap5s1.L
chr7L:57739947..57739971 25/25 Antisense off-target ctnnbip1.L
chr1S:53383541..53383565 21/25 Antisense off-target fat4.S
chr3L:137561868..137561892 21/25 Antisense off-target LOC108710418 [provisional:casr]
chr3L:85123306..85123330 21/25 Antisense off-target Xelaev18018096m
chr6S:28709109..28709133 21/25 Antisense off-target dgkb.S
chr7L:33165608..33165632 21/25 Antisense off-target LOC108696198
chr7S:82615369..82615393 21/25 Antisense off-target prkcg.S
chr8S:98317287..98317311 21/25 Sense off-target efna3.S
chr3L:92161703..92161727 21/25 unknown
chr6L:78077682..78077706 21/25 unknown
tropicalis 10.0 Chr7:63492426..63492450 25/25 Antisense target ap5s1
Chr3:78135097..78135121 22/25 Antisense off-target ccdc146
Chr1:180626718..180626742 21/25 Antisense off-target edil3
Chr4:104283812..104283836 21/25 Antisense off-target dipk1a
Chr4:59297097..59297121 21/25 Sense off-target urah
Chr8:92429749..92429773 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers