Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311399

Morpholino Name: cda MO1
Synonyms: CDD, TNeu059k10, Xtnovel30
Target mRNA: cda

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCAGTTGCTATTCCCATCCATCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGGATGGATGGGAATAGCAACTGCC 3' ||||||||||||||||||||||||| 3' CCCTACCTACCCTTATCGTTGACGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:90998371..90998395 22/25 Sense off-target appbp2.L
chr6L:66284289..66284313 22/25 unknown
chr4L:14815918..14815942 21/25 unknown
tropicalis 10.0 Chr7:129545100..129545124 25/25 Antisense target cda
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers