Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311400

Morpholino Name: uba5 MO1
Synonyms: TNeu098a04, xtnovel31
Target mRNA: uba5

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTCCATTAGTGCTGAATAAGTAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CCTACTTATTCAGCACTAATGGAGA 3' ||||||||||||||||||||||||| 3' GGATGAATAAGTCGTGATTACCTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:7453256..7453280 21/25 Antisense off-target kcnb1.S
tropicalis 10.0 Chr6:52919311..52919335 25/25 Antisense target uba5
Chr5:126127541..126127565 21/25 Antisense off-target crocc2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers