Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311401

Morpholino Name: arl8a MO1
Synonyms: TNeu057j21, Xtnovel32
Target mRNA: arl8a

Morpholino Type: uncategorized morpholino
Sequence: 5' GAATAAGGCCAACATCTCCAGTGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' CGCACTGGAGATGTTGGCCTTATTC 3' ||||||||||||||||||||||||| 3' GCGTGACCTCTACAACCGGAATAAG 5' 5' CGTACTGGAGATGCTGGCCTTATTC 3' || |||||||||| ||||||||||| 3' GCGTGACCTCTACAACCGGAATAAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:58007323..58007347 23/25 Antisense target arl8a.S
Scaffold38:1896096..1896120 24/25 Antisense off-target LOC108704542 [provisional:arl8a]
tropicalis 10.0 Chr2:72615522..72615546 25/25 Antisense target arl8a
Chr1:180402355..180402379 22/25 Antisense off-target edil3
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers