Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311402

Morpholino Name: miga2 MO1
Synonyms: TNeu129e04, Xtnovel33, fam73b
Target mRNA: miga2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTCTGCTCTCTGAAATGCCATAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' GCTATGGCATTTCAGAGAGCAGAGG 3' ||||||||||||||||||||||||| 3' CGATACCGTAAAGTCTCTCGTCTCC 5' 5' GCGATGGCGTTTCAGAGAGCAGAGG 3' || ||||| |||||||||||||||| 3' CGATACCGTAAAGTCTCTCGTCTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold46:595986..596010 23/25 Antisense target miga2.L
chr9_10L:74737113..74737137 22/25 Antisense off-target ikzf2.L
chr9_10S:69199983..69200007 22/25 Sense off-target rab5d.S
chr1L:129224354..129224378 21/25 Sense off-target anxa1.3.L
chr6S:50419428..50419452 21/25 Sense off-target LOC108720009 [provisional:mplkip]
Scaffold105857:147..171 22/25 unknown
chr2L:132496075..132496099 21/25 unknown
chr3L:139022304..139022328 21/25 unknown
chr4S:27002573..27002597 21/25 unknown
chr6L:113989688..113989712 21/25 unknown
tropicalis 10.0 Chr8:21664761..21664785 25/25 Antisense target miga2
Chr6:50927430..50927454 22/25 Sense off-target ano10
Chr4:106348781..106348805 21/25 Sense off-target lmo4.1
Chr8:18967079..18967103 21/25 Antisense off-target LOC108644519
Chr8:20189058..20189082 21/25 Antisense off-target LOC101730485
Chr8:21004807..21004831 21/25 Antisense off-target LOC108645164
Chr8:21004807..21004831 21/25 Antisense off-target LOC101734547
Chr8:21004807..21004831 21/25 Antisense off-target Xetrov107052752m.g
Chr8:30989918..30989942 21/25 Antisense off-target Xetrov107053355m.g
Chr8:31164852..31164876 21/25 Antisense off-target LOC101732742
Chr8:31164852..31164876 21/25 Antisense off-target Xetrov107053358m.g
Chr8:25005886..25005910 23/25 unknown
Chr8:19731771..19731795 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers