Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311403

Morpholino Name: hmgn2 MO2
Synonyms: HMG17, TNeu136h04, Xtnovel35
Target mRNA: hmgn2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATCAGCCTTTCTCTTGGGCATTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:2716045..2716069 21/25 Sense off-target LOC108698165
Scaffold16685:120..144 21/25 unknown
Scaffold9484:717..741 21/25 unknown
chr2S:37137583..37137607 21/25 unknown
chr2S:37537037..37537061 21/25 unknown
chr2S:64828790..64828814 21/25 unknown
tropicalis 10.0 Chr2:5378038..5378062 21/25 Sense off-target lsamp
Chr7:56739641..56739665 21/25 Sense off-target slc43a1
Chr5:128315868..128315892 21/25 unknown
Chr7:16358059..16358083 21/25 unknown
Chr9:73882976..73883000 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers