Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311405

Morpholino Name: rtfdc1 MO2
Synonyms: TNeu018d13, Xtnovel36.2
Target mRNA: rtf2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTTAGTCAGTCACCAAAACAAAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/24
genomic

MO
5' GTTTGTTTTGGTGACTGACTAAAC 3' ||||||||||||||||||||||| 3' TAAACAAAACCACTGACTGATTTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold80:533781..533804 20/24 Antisense off-target phldb1.S
chr3S:18852437..18852460 20/24 Antisense off-target dnajb1.S
chr3S:73976663..73976686 20/24 Antisense off-target LOC108712353 [provisional:tbc1d22a]
chr8L:25021818..25021841 20/24 Antisense off-target usp12b.L
chr2L:45812379..45812402 20/24 unknown
chr4L:78326744..78326767 20/24 unknown
chr4S:32478570..32478593 20/24 unknown
chr4S:72467553..72467576 20/24 unknown
tropicalis 10.0 Chr10:6026851..6026874 23/24 Antisense target rtf2
Chr1:14180564..14180587 20/24 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers