Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311406

Morpholino Name: spata6l MO1
Synonyms: TNeu024k05, Xtnovel37
Target mRNA: spata6l

Morpholino Type: uncategorized morpholino
Sequence: 5' CGATCACAATTTTTAATGGCATGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CACATGCCATTAAAAATTGTGATCG 3' ||||||||||||||||||||||||| 3' GTGTACGGTAATTTTTAACACTAGC 5' 5' CACATGCCGTTAAAAATTGTGATCG 3' |||||||| |||||||||||||||| 3' GTGTACGGTAATTTTTAACACTAGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:125436279..125436303 24/25 Antisense target spata6l.L
chr6L:129498840..129498864 22/25 Antisense off-target vps13b.L
chr1S:64077258..64077282 21/25 Antisense off-target Xelaev18009447m
tropicalis 10.0 Chr1:127332448..127332472 25/25 Antisense target spata6l
Chr1:108354768..108354792 21/25 Antisense off-target hsdl2
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers