Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311409

Morpholino Name: myo18b MO2
Synonyms: TNeu053k08, Xtnovel39.2
Target mRNA: myo18b

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTACTCTATGGAAAGGTGCCTTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACAAGGCACCTTTCCATAGAGTAAC 3' ||||||||||||||||||||||||| 3' TGTTCCGTGGAAAGGTATCTCATTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:147208587..147208611 22/25 Antisense off-target LOC108715734 [provisional:myo18b]
chr1L:22336567..22336591 21/25 Sense off-target LOC108698051 [provisional:slit2]
chr1S:19677332..19677356 21/25 Sense off-target slit2.S
chr1S:93234879..93234903 21/25 Antisense off-target musk.S
tropicalis 10.0 Chr1:148056500..148056524 25/25 Antisense target myo18b
Chr1:162657036..162657060 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers