Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311410

Morpholino Name: ubtd2 MO1
Synonyms: TGas076c07, Xtnovel4
Target mRNA: ubtd2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTGAGTGCCCACACACCCTCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' ATGGGAGGGTGTGTGGGCACTCACC 3' ||||||||||||||||||||||||| 3' TACCCTCCCACACACCCGTGAGTGG 5' 5' ATGGGAGGGTGTGTGGGCACTCACC 3' ||||||||||||||||||||||||| 3' TACCCTCCCACACACCCGTGAGTGG 5' 5' ATGGGAGGGTGTGTGGGAACTCACC 3' ||||||||||||||||| ||||||| 3' TACCCTCCCACACACCCGTGAGTGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:34561887..34561911 25/25 Antisense target ubtd2.L
chr3S:103786330..103786354 24/25 Antisense target ubtd2.S
chr6L:126817454..126817478 21/25 unknown
tropicalis 10.0 Chr3:41354159..41354183 25/25 Antisense target ubtd2
Chr8:81597263..81597287 22/25 Sense off-target plekhg2
Chr4:140790136..140790160 21/25 Sense off-target foxp1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers