Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311412

Morpholino Name: sugt1 MO2
Synonyms: TNeu104f22, Xtnovel41
Target mRNA: sugt1

Morpholino Type: uncategorized morpholino
Sequence: 5' AACAGCTCTCTCTGTCATGTTTATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATAAACATGACAGAGAGAGCTGTT 3' ||||||||||||||||||||||||| 3' GTATTTGTACTGTCTCTCTCGACAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:41629891..41629915 22/25 Antisense off-target glra3.L
chr1L:204510561..204510585 21/25 Antisense off-target npr3.L
chr2L:115072748..115072772 21/25 Sense off-target atp11a.L
chr4L:103155416..103155440 21/25 Sense off-target nr5a2.L
chr6L:92116867..92116891 21/25 Antisense off-target gmpr.L
chr8S:20262048..20262072 21/25 Sense off-target fam181a.S
chr1S:151937360..151937384 21/25 unknown
chr5S:127511701..127511725 21/25 unknown
chr8L:54509168..54509192 21/25 unknown
tropicalis 10.0 Chr2:132227977..132228001 25/25 Antisense target sugt1
Chr6:121544782..121544806 21/25 Sense off-target gdap1
Chr7:77829183..77829207 21/25 Antisense off-target crtam
Chr6:123464633..123464657 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers