Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311419

Morpholino Name: ubn2 MO1
Synonyms: TEgg140p11, Xtnovel47
Target mRNA: ubn2

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGCTCCGCCATTCCTTCCTCTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' GAGAGAGGAAGGAATGGCGGAGCCG 3' ||||||||||||||||||||||||| 3' CTCTCTCCTTCCTTACCGCCTCGGC 5' 5' GTGTGAAGAAAGAATGGCGGAGCCG 3' | | || ||| |||||||||||||| 3' CTCTCTCCTTCCTTACCGCCTCGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:87307274..87307298 21/25 Antisense target ubn2.S
chr4L:106569948..106569972 24/25 Antisense off-target LOC108714465 [provisional:ubn2]
chr8L:23720426..23720450 21/25 Antisense off-target cul4b.L
chr1L:69622253..69622277 21/25 unknown
chr6L:95624154..95624178 21/25 unknown
tropicalis 10.0 Chr4:114757534..114757558 25/25 Antisense target ubn2
Chr4:114757534..114757558 25/25 Sense off-target gucy2c
Chr8:64642591..64642615 21/25 Antisense off-target sytl4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers