Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311420

Morpholino Name: ubn2 MO2
Synonyms: TEgg140p11, Xtnovel47.2
Target mRNA: ubn2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTCACACACACAGTCTCTCACAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCTGTGAGAGACTGTGTGTGTGAGT 3' ||||||||||||||||||||||||| 3' CGACACTCTCTGACACACACACTCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold22:2809642..2809666 23/25 Antisense off-target LOC108703739
Scaffold21:5608230..5608254 22/25 Sense off-target palm2akap2.S
Scaffold81:187299..187323 22/25 Antisense off-target kank2.L
chr1L:152884979..152885003 22/25 Antisense off-target slc2a11.3.L
chr1L:80399481..80399505 22/25 Antisense off-target aff1.L
chr2L:153421191..153421215 22/25 Sense off-target cog6.L
chr6S:41541238..41541262 22/25 Antisense off-target osbpl10.S
chr6S:41541238..41541262 22/25 Antisense off-target LOC108719690 [provisional:osbpl10]
chr6S:94043147..94043171 22/25 Sense off-target chd7.S
chr7L:92496054..92496078 22/25 Sense off-target nphp4.2.L
chr8S:14077885..14077909 22/25 Antisense off-target fermt2.S
chr9_10L:32993882..32993906 22/25 Sense off-target LOC108701804 [provisional:dram1]
Scaffold103:280191..280215 21/25 Sense off-target plp2.L
Scaffold19:3419961..3419985 21/25 Sense off-target LOC108703378
Scaffold20:7980618..7980642 21/25 Antisense off-target ybx2.S
Scaffold205:4002..4026 21/25 Sense off-target LOC108705600 [provisional:prkcd]
Scaffold24:1803707..1803731 21/25 Antisense off-target cacna2d3.L
Scaffold29:37118..37142 21/25 Antisense off-target Xetrov90030523m.S
Scaffold29:37118..37142 21/25 Antisense off-target fbxl16.S
Scaffold29:37194..37218 21/25 Antisense off-target Xetrov90030523m.S
Scaffold29:37194..37218 21/25 Antisense off-target fbxl16.S
Scaffold40:63946..63970 21/25 Sense off-target Xelaev18003029m
Scaffold42:871334..871358 21/25 Sense off-target LOC108704616 [provisional:kcnh2]
Scaffold90:89383..89407 21/25 Antisense off-target mpp6.L
Scaffold90:89551..89575 21/25 Antisense off-target mpp6.L
chr1L:180526544..180526568 21/25 Sense off-target nr2f1.L
chr1L:180526590..180526614 21/25 Sense off-target nr2f1.L
chr1L:180526626..180526650 21/25 Sense off-target nr2f1.L
chr1L:180526684..180526708 21/25 Sense off-target nr2f1.L
chr1L:180526724..180526748 21/25 Sense off-target nr2f1.L
chr1L:180526770..180526794 21/25 Sense off-target nr2f1.L
chr1L:182076659..182076683 21/25 Antisense off-target LOC100488885-like.L
chr1L:219631387..219631411 21/25 Antisense off-target LOC108719266
chr1S:171848978..171849002 21/25 Antisense off-target mbd2.S
chr1S:173651312..173651336 21/25 Antisense off-target ctif.S
chr2L:1354314..1354338 21/25 Antisense off-target gsk3b.L
chr2L:161552885..161552909 21/25 Antisense off-target zdhhc20.L
chr2L:161553199..161553223 21/25 Antisense off-target zdhhc20.L
chr2L:161553217..161553241 21/25 Antisense off-target zdhhc20.L
chr2L:161553235..161553259 21/25 Antisense off-target zdhhc20.L
chr2L:179572349..179572373 21/25 Sense off-target znf300.L
chr2L:179572365..179572389 21/25 Sense off-target znf300.L
chr2L:179573349..179573373 21/25 Sense off-target znf300.L
chr2L:179573811..179573835 21/25 Sense off-target znf300.L
chr2L:179574383..179574407 21/25 Sense off-target znf300.L
chr2L:179574383..179574407 21/25 Antisense off-target LOC108707634
chr2S:58395400..58395424 21/25 Sense off-target nuak2.S
chr2S:8784431..8784455 21/25 Sense off-target st3gal6.S
chr2S:8784477..8784501 21/25 Sense off-target st3gal6.S
chr3L:122663720..122663744 21/25 Antisense off-target slc39a14.L
chr3L:1270264..1270288 21/25 Antisense off-target sox5.L
chr3L:1270408..1270432 21/25 Antisense off-target sox5.L
chr3L:1864899..1864923 21/25 Sense off-target LOC108710178 [provisional:itpr2]
chr3L:1865043..1865067 21/25 Sense off-target LOC108710178 [provisional:itpr2]
chr3L:82345099..82345123 21/25 Sense off-target LOC108711294
chr3L:82345155..82345179 21/25 Sense off-target LOC108711294
chr4L:36189463..36189487 21/25 Sense off-target znf423.L
chr4L:37700374..37700398 21/25 Antisense off-target slc7a6.L
chr4S:7360267..7360291 21/25 Antisense off-target mrpl23.S
chr4S:7756830..7756854 21/25 Sense off-target Xelaev18024372m
chr4S:7756830..7756854 21/25 Sense off-target LOC108715206 [provisional:mob2]
chr4S:7757060..7757084 21/25 Sense off-target Xelaev18024372m
chr4S:7757060..7757084 21/25 Sense off-target LOC108715206 [provisional:mob2]
chr4S:96842194..96842218 21/25 Sense off-target LOC100137672.S
chr4S:96842194..96842218 21/25 Sense off-target LOC108715807 [provisional:shisa5]
chr5L:339802..339826 21/25 Antisense off-target plcb4.L
chr5S:26702665..26702689 21/25 Sense off-target plcb1.S
chr5S:6165300..6165324 21/25 Antisense off-target ttbk1.S
chr5S:67842170..67842194 21/25 Sense off-target Xelaev18029362m
chr5S:7485858..7485882 21/25 Antisense off-target btbd9.S
chr5S:7485900..7485924 21/25 Antisense off-target btbd9.S
chr5S:7485950..7485974 21/25 Antisense off-target btbd9.S
chr6L:139672499..139672523 21/25 Sense off-target trpv4l.1.L
chr6L:139672697..139672721 21/25 Sense off-target trpv4l.1.L
chr6L:14713468..14713492 21/25 Sense off-target esyt2.L
chr6L:153411417..153411441 21/25 Antisense off-target gpt.L
chr6L:153411417..153411441 21/25 Sense off-target Xelaev18032510m
chr6L:153411555..153411579 21/25 Antisense off-target gpt.L
chr6L:153411555..153411579 21/25 Sense off-target Xelaev18032510m
chr6L:153411684..153411708 21/25 Antisense off-target gpt.L
chr6L:153411684..153411708 21/25 Sense off-target Xelaev18032510m
chr6L:153411848..153411872 21/25 Antisense off-target gpt.L
chr6L:153411848..153411872 21/25 Sense off-target Xelaev18032510m
chr6S:127641667..127641691 21/25 Antisense off-target plec.S
chr6S:127641667..127641691 21/25 Sense off-target Xelaev18034126m
chr6S:2952308..2952332 21/25 Antisense off-target dhx30.S
chr6S:2952330..2952354 21/25 Antisense off-target dhx30.S
chr6S:730317..730341 21/25 Antisense off-target LOC108719641 [provisional:kcnh2]
chr6S:89010341..89010365 21/25 Sense off-target garem1.S
chr6S:89010357..89010381 21/25 Sense off-target garem1.S
chr6S:89010373..89010397 21/25 Sense off-target garem1.S
chr6S:89010465..89010489 21/25 Sense off-target garem1.S
chr6S:89010523..89010547 21/25 Sense off-target garem1.S
chr6S:89010567..89010591 21/25 Sense off-target garem1.S
chr6S:96253078..96253102 21/25 Antisense off-target LOC108695329 [provisional:arfgef1]
chr6S:96253090..96253114 21/25 Antisense off-target LOC108695329 [provisional:arfgef1]
chr6S:96253261..96253285 21/25 Antisense off-target LOC108695329 [provisional:arfgef1]
chr6S:96253277..96253301 21/25 Antisense off-target LOC108695329 [provisional:arfgef1]
chr6S:96253480..96253504 21/25 Antisense off-target LOC108695329 [provisional:arfgef1]
chr7L:103416096..103416120 21/25 Sense off-target ceacam8l.L
chr7L:121661439..121661463 21/25 Antisense off-target LOC108696863 [provisional:camk2n1]
chr7L:53229625..53229649 21/25 Antisense off-target zdhhc5.L
chr7L:67984625..67984649 21/25 Sense off-target LOC108696393
chr7S:12098748..12098772 21/25 Sense off-target stk32c.S
chr7S:20736814..20736838 21/25 Sense off-target kcnip2-like.S
chr8L:16286716..16286740 21/25 Antisense off-target gabra3.L
chr8L:58620093..58620117 21/25 Sense off-target pak4.L
chr8S:98088542..98088566 21/25 Sense off-target pip5k1a.S
chr9_10L:5575851..5575875 21/25 Antisense off-target gjc1.L
chr9_10S:1906822..1906846 21/25 Antisense off-target erbb2.S
chr9_10S:695863..695887 21/25 Antisense off-target dnajc7.S
Scaffold105806:44..68 22/25 unknown
Scaffold110283:140..164 22/25 unknown
Scaffold23:3415005..3415029 22/25 unknown
Scaffold37922:326..350 22/25 unknown
Scaffold49918:390..414 22/25 unknown
Scaffold57040:224..248 22/25 unknown
Scaffold64017:319..343 22/25 unknown
Scaffold66:226716..226740 22/25 unknown
chr1L:124388010..124388034 22/25 unknown
chr1L:87576827..87576851 22/25 unknown
chr1L:97089943..97089967 22/25 unknown
chr2L:14216873..14216897 22/25 unknown
chr2L:171781223..171781247 22/25 unknown
chr2S:71127174..71127198 22/25 unknown
chr5S:28007408..28007432 22/25 unknown
chr5S:86431908..86431932 22/25 unknown
chr6L:145798891..145798915 22/25 unknown
chr7L:119191133..119191157 22/25 unknown
chr7L:43429024..43429048 22/25 unknown
chr7S:15867319..15867343 22/25 unknown
chr8L:36251445..36251469 22/25 unknown
chr9_10S:30831016..30831040 22/25 unknown
Scaffold113484:14..38 21/25 unknown
Scaffold19385:581..605 21/25 unknown
Scaffold19934:89..113 21/25 unknown
Scaffold207:42676..42700 21/25 unknown
Scaffold27:3409794..3409818 21/25 unknown
Scaffold31:1461349..1461373 21/25 unknown
Scaffold32:1434787..1434811 21/25 unknown
Scaffold3707:53..77 21/25 unknown
Scaffold49535:137..161 21/25 unknown
Scaffold49535:81..105 21/25 unknown
Scaffold54:374635..374659 21/25 unknown
Scaffold56931:302..326 21/25 unknown
Scaffold6107:1070..1094 21/25 unknown
Scaffold63284:327..351 21/25 unknown
Scaffold68187:239..263 21/25 unknown
Scaffold68187:75..99 21/25 unknown
Scaffold80:570982..571006 21/25 unknown
Scaffold96:252984..253008 21/25 unknown
Scaffold96:253032..253056 21/25 unknown
Scaffold9646:51..75 21/25 unknown
chr1L:123128688..123128712 21/25 unknown
chr1L:15482939..15482963 21/25 unknown
chr1L:15483307..15483331 21/25 unknown
chr1L:219309962..219309986 21/25 unknown
chr1L:73828957..73828981 21/25 unknown
chr1S:3368234..3368258 21/25 unknown
chr1S:3368322..3368346 21/25 unknown
chr1S:62762501..62762525 21/25 unknown
chr1S:62763059..62763083 21/25 unknown
chr1S:62763689..62763713 21/25 unknown
chr2L:104209082..104209106 21/25 unknown
chr2L:1144100..1144124 21/25 unknown
chr2L:177732974..177732998 21/25 unknown
chr2L:38342524..38342548 21/25 unknown
chr3S:50859161..50859185 21/25 unknown
chr4L:106166841..106166865 21/25 unknown
chr4L:50773985..50774009 21/25 unknown
chr4S:13336168..13336192 21/25 unknown
chr4S:28379052..28379076 21/25 unknown
chr5L:130107519..130107543 21/25 unknown
chr5L:137075043..137075067 21/25 unknown
chr5L:17487148..17487172 21/25 unknown
chr5L:54122782..54122806 21/25 unknown
chr5S:109021264..109021288 21/25 unknown
chr5S:112646634..112646658 21/25 unknown
chr5S:70463580..70463604 21/25 unknown
chr5S:86431996..86432020 21/25 unknown
chr5S:86432012..86432036 21/25 unknown
chr5S:96714506..96714530 21/25 unknown
chr5S:96715621..96715645 21/25 unknown
chr6L:36215717..36215741 21/25 unknown
chr6L:90113488..90113512 21/25 unknown
chr6S:14241507..14241531 21/25 unknown
chr6S:35815088..35815112 21/25 unknown
chr6S:35815300..35815324 21/25 unknown
chr6S:97265078..97265102 21/25 unknown
chr6S:97265138..97265162 21/25 unknown
chr6S:97265333..97265357 21/25 unknown
chr7L:119191051..119191075 21/25 unknown
chr7L:120541276..120541300 21/25 unknown
chr7L:41111178..41111202 21/25 unknown
chr7L:60773060..60773084 21/25 unknown
chr7S:18518927..18518951 21/25 unknown
chr7S:33263612..33263636 21/25 unknown
chr7S:73166682..73166706 21/25 unknown
chr7S:78401093..78401117 21/25 unknown
chr8L:115468850..115468874 21/25 unknown
chr8L:115618868..115618892 21/25 unknown
chr8L:118636165..118636189 21/25 unknown
chr8L:119400413..119400437 21/25 unknown
chr8L:119489940..119489964 21/25 unknown
chr8L:25067983..25068007 21/25 unknown
chr8L:42562437..42562461 21/25 unknown
chr8S:1037512..1037536 21/25 unknown
chr8S:53847881..53847905 21/25 unknown
chr8S:57280384..57280408 21/25 unknown
chr9_10L:35129360..35129384 21/25 unknown
chr9_10L:42546545..42546569 21/25 unknown
chr9_10S:20499591..20499615 21/25 unknown
chr9_10S:30202065..30202089 21/25 unknown
chr9_10S:42013468..42013492 21/25 unknown
tropicalis 10.0 Chr4:114757509..114757533 25/25 Antisense target ubn2
Chr4:114757509..114757533 25/25 Sense off-target gucy2c
Chr1:65789882..65789906 22/25 Antisense off-target spata5
Chr2:1467486..1467510 22/25 Sense off-target icoslg
Chr4:151142172..151142196 22/25 Sense off-target timp4
Chr4:151142172..151142196 22/25 Antisense off-target syn2
Chr4:66775083..66775107 22/25 Sense off-target zc3h18
Chr4:66775109..66775133 22/25 Sense off-target zc3h18
Chr4:66775131..66775155 22/25 Sense off-target zc3h18
Chr4:66775151..66775175 22/25 Sense off-target zc3h18
Chr4:66775173..66775197 22/25 Sense off-target zc3h18
Chr4:66775193..66775217 22/25 Sense off-target zc3h18
Chr4:66775213..66775237 22/25 Sense off-target zc3h18
Chr4:66775233..66775257 22/25 Sense off-target zc3h18
Chr4:66775253..66775277 22/25 Sense off-target zc3h18
Chr4:66775291..66775315 22/25 Sense off-target zc3h18
Chr4:66775313..66775337 22/25 Sense off-target zc3h18
Chr4:66775333..66775357 22/25 Sense off-target zc3h18
Chr4:66775401..66775425 22/25 Sense off-target zc3h18
Chr4:66775439..66775463 22/25 Sense off-target zc3h18
Chr4:66775459..66775483 22/25 Sense off-target zc3h18
Chr4:66775559..66775583 22/25 Sense off-target zc3h18
Chr4:66775583..66775607 22/25 Sense off-target zc3h18
Chr4:66775635..66775659 22/25 Sense off-target zc3h18
Chr4:66775683..66775707 22/25 Sense off-target zc3h18
Chr4:66775729..66775753 22/25 Sense off-target zc3h18
Chr4:66775749..66775773 22/25 Sense off-target zc3h18
Chr4:66775773..66775797 22/25 Sense off-target zc3h18
Chr4:66775797..66775821 22/25 Sense off-target zc3h18
Chr4:66775827..66775851 22/25 Sense off-target zc3h18
Chr4:66775847..66775871 22/25 Sense off-target zc3h18
Chr4:66775867..66775891 22/25 Sense off-target zc3h18
Chr4:66775887..66775911 22/25 Sense off-target zc3h18
Chr4:66775913..66775937 22/25 Sense off-target zc3h18
Chr4:66775958..66775982 22/25 Sense off-target zc3h18
Chr6:7546834..7546858 22/25 Antisense off-target plcd1
Chr8:1630002..1630026 22/25 Sense off-target grin1
Chr8:70091727..70091751 22/25 Antisense off-target atp11c
Chr1:179743152..179743176 21/25 Sense off-target tmem161b
Chr1:65789306..65789330 21/25 Antisense off-target spata5
Chr1:65789676..65789700 21/25 Antisense off-target spata5
Chr1:65789696..65789720 21/25 Antisense off-target spata5
Chr1:65789716..65789740 21/25 Antisense off-target spata5
Chr1:65789782..65789806 21/25 Antisense off-target spata5
Chr1:65789802..65789826 21/25 Antisense off-target spata5
Chr10:34791044..34791068 21/25 Sense off-target tshz2
Chr10:41357532..41357556 21/25 Antisense off-target raly
Chr10:50859380..50859404 21/25 Sense off-target cep112
Chr10:50859380..50859404 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859380..50859404 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859420..50859444 21/25 Sense off-target cep112
Chr10:50859420..50859444 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859420..50859444 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859504..50859528 21/25 Sense off-target cep112
Chr10:50859504..50859528 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859504..50859528 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859584..50859608 21/25 Sense off-target cep112
Chr10:50859584..50859608 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859584..50859608 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859654..50859678 21/25 Sense off-target cep112
Chr10:50859654..50859678 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859654..50859678 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859670..50859694 21/25 Sense off-target cep112
Chr10:50859670..50859694 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859670..50859694 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859686..50859710 21/25 Sense off-target cep112
Chr10:50859686..50859710 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859686..50859710 21/25 Antisense off-target Xetrov107011936m.g
Chr10:50859702..50859726 21/25 Sense off-target cep112
Chr10:50859702..50859726 21/25 Antisense off-target Xetrov107011935m.g
Chr10:50859702..50859726 21/25 Antisense off-target Xetrov107011936m.g
Chr10:6228315..6228339 21/25 Sense off-target LOC101732252
Chr10:6228351..6228375 21/25 Sense off-target LOC101732252
Chr10:6228381..6228405 21/25 Sense off-target LOC101732252
Chr10:6228417..6228441 21/25 Sense off-target LOC101732252
Chr10:6228439..6228463 21/25 Sense off-target LOC101732252
Chr10:6228475..6228499 21/25 Sense off-target LOC101732252
Chr2:125810..125834 21/25 Antisense off-target recql4
Chr2:125856..125880 21/25 Antisense off-target recql4
Chr2:132031689..132031713 21/25 Sense off-target Xetrov107017384m.g
Chr2:135821081..135821105 21/25 Sense off-target adcy6
Chr2:135821095..135821119 21/25 Sense off-target adcy6
Chr2:440921..440945 21/25 Antisense off-target Xetrov107012113m.g
Chr2:440945..440969 21/25 Antisense off-target Xetrov107012113m.g
Chr2:440989..441013 21/25 Antisense off-target Xetrov107012113m.g
Chr2:441013..441037 21/25 Antisense off-target Xetrov107012113m.g
Chr2:6769686..6769710 21/25 Antisense off-target tmem39a
Chr2:6769702..6769726 21/25 Antisense off-target tmem39a
Chr2:6769782..6769806 21/25 Antisense off-target tmem39a
Chr2:6769798..6769822 21/25 Antisense off-target tmem39a
Chr3:151715348..151715372 21/25 Sense off-target Xetrov107027547m.g
Chr3:339192..339216 21/25 Sense off-target Xetrov107019725m.g
Chr3:3548872..3548896 21/25 Antisense off-target wnt7b
Chr3:3549030..3549054 21/25 Antisense off-target wnt7b
Chr3:3549166..3549190 21/25 Antisense off-target wnt7b
Chr3:3549222..3549246 21/25 Antisense off-target wnt7b
Chr3:3549344..3549368 21/25 Antisense off-target wnt7b
Chr3:3549374..3549398 21/25 Antisense off-target wnt7b
Chr3:3549898..3549922 21/25 Antisense off-target wnt7b
Chr3:3549926..3549950 21/25 Antisense off-target wnt7b
Chr3:3550098..3550122 21/25 Antisense off-target wnt7b
Chr3:404244..404268 21/25 Sense off-target lmo3
Chr3:404492..404516 21/25 Sense off-target lmo3
Chr4:114225458..114225482 21/25 Sense off-target grin2b
Chr4:126398088..126398112 21/25 Sense off-target LOC100496572
Chr4:129783061..129783085 21/25 Sense off-target cntn4
Chr4:153120815..153120839 21/25 Antisense off-target nisch
Chr4:153120815..153120839 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153120839..153120863 21/25 Antisense off-target nisch
Chr4:153120839..153120863 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121151..153121175 21/25 Antisense off-target nisch
Chr4:153121151..153121175 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121191..153121215 21/25 Antisense off-target nisch
Chr4:153121191..153121215 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121215..153121239 21/25 Antisense off-target nisch
Chr4:153121215..153121239 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121533..153121557 21/25 Antisense off-target nisch
Chr4:153121533..153121557 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121595..153121619 21/25 Antisense off-target nisch
Chr4:153121595..153121619 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121927..153121951 21/25 Antisense off-target nisch
Chr4:153121927..153121951 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121953..153121977 21/25 Antisense off-target nisch
Chr4:153121953..153121977 21/25 Antisense off-target Xetrov107034737m.g
Chr4:153121979..153122003 21/25 Antisense off-target nisch
Chr4:153121979..153122003 21/25 Antisense off-target Xetrov107034737m.g
Chr4:376299..376323 21/25 Sense off-target ptpn5
Chr4:376453..376477 21/25 Sense off-target ptpn5
Chr4:66774983..66775007 21/25 Sense off-target zc3h18
Chr4:66775007..66775031 21/25 Sense off-target zc3h18
Chr4:66775031..66775055 21/25 Sense off-target zc3h18
Chr4:66775055..66775079 21/25 Sense off-target zc3h18
Chr4:66775365..66775389 21/25 Sense off-target zc3h18
Chr4:66775383..66775407 21/25 Sense off-target zc3h18
Chr4:66775419..66775443 21/25 Sense off-target zc3h18
Chr4:66775481..66775505 21/25 Sense off-target zc3h18
Chr4:66775605..66775629 21/25 Sense off-target zc3h18
Chr4:66775649..66775673 21/25 Sense off-target zc3h18
Chr4:66775663..66775687 21/25 Sense off-target zc3h18
Chr4:66775703..66775727 21/25 Sense off-target zc3h18
Chr4:66775994..66776018 21/25 Sense off-target zc3h18
Chr4:66776078..66776102 21/25 Sense off-target zc3h18
Chr4:66776092..66776116 21/25 Sense off-target zc3h18
Chr4:66776316..66776340 21/25 Sense off-target zc3h18
Chr4:66776332..66776356 21/25 Sense off-target zc3h18
Chr4:709941..709965 21/25 Sense off-target otog
Chr4:709941..709965 21/25 Sense off-target Xetrov107027714m.g
Chr5:1261697..1261721 21/25 Sense off-target epha8
Chr5:1261713..1261737 21/25 Sense off-target epha8
Chr5:1262047..1262071 21/25 Sense off-target epha8
Chr5:1262345..1262369 21/25 Sense off-target epha8
Chr5:14987937..14987961 21/25 Sense off-target Xetrov107035274m.g
Chr5:14987937..14987961 21/25 Sense off-target LOC733493
Chr6:1014564..1014588 21/25 Sense off-target slc4a2
Chr6:1015289..1015313 21/25 Sense off-target slc4a2
Chr6:1015315..1015339 21/25 Sense off-target slc4a2
Chr6:1015463..1015487 21/25 Sense off-target slc4a2
Chr6:1214158..1214182 21/25 Antisense off-target Xetrov107040731m.g
Chr6:142190732..142190756 21/25 Antisense off-target asap1
Chr6:142190796..142190820 21/25 Antisense off-target asap1
Chr6:142190894..142190918 21/25 Antisense off-target asap1
Chr6:142190992..142191016 21/25 Antisense off-target asap1
Chr6:142191048..142191072 21/25 Antisense off-target asap1
Chr6:142192108..142192132 21/25 Antisense off-target asap1
Chr6:142192172..142192196 21/25 Antisense off-target asap1
Chr6:142192332..142192356 21/25 Antisense off-target asap1
Chr6:142192428..142192452 21/25 Antisense off-target asap1
Chr6:142192534..142192558 21/25 Antisense off-target asap1
Chr6:142192602..142192626 21/25 Antisense off-target asap1
Chr6:153380197..153380221 21/25 Antisense off-target arhgap39
Chr6:153388389..153388413 21/25 Sense off-target arhgap39
Chr6:153388453..153388477 21/25 Sense off-target arhgap39
Chr6:153388595..153388619 21/25 Sense off-target arhgap39
Chr6:153388623..153388647 21/25 Sense off-target arhgap39
Chr6:28264732..28264756 21/25 Sense off-target cacnb2
Chr6:28264822..28264846 21/25 Sense off-target cacnb2
Chr6:44085236..44085260 21/25 Sense off-target rftn1
Chr6:7356737..7356761 21/25 Sense off-target myd88
Chr6:7357079..7357103 21/25 Sense off-target myd88
Chr6:7357159..7357183 21/25 Sense off-target myd88
Chr6:7357231..7357255 21/25 Sense off-target myd88
Chr6:7357293..7357317 21/25 Sense off-target myd88
Chr6:7357363..7357387 21/25 Sense off-target myd88
Chr6:7357495..7357519 21/25 Sense off-target myd88
Chr6:7357569..7357593 21/25 Sense off-target myd88
Chr7:106744793..106744817 21/25 Antisense off-target arhgef1
Chr7:112986506..112986530 21/25 Sense off-target pih1d1
Chr7:129969838..129969862 21/25 Sense off-target capzb
Chr7:129971626..129971650 21/25 Sense off-target capzb
Chr7:129971908..129971932 21/25 Sense off-target capzb
Chr7:129971934..129971958 21/25 Sense off-target capzb
Chr7:6060459..6060483 21/25 Antisense off-target fam204a
Chr7:6060569..6060593 21/25 Antisense off-target fam204a
Chr7:6352466..6352490 21/25 Antisense off-target bag3
Chr7:7793375..7793399 21/25 Antisense off-target LOC100491523
Chr7:7793375..7793399 21/25 Antisense off-target Xetrov107046317m.g
Chr8:10890303..10890327 21/25 Antisense off-target LOC116406899
Chr8:10890303..10890327 21/25 Sense off-target Xetrov107052389m.g
Chr8:10890319..10890343 21/25 Antisense off-target LOC116406899
Chr8:10890319..10890343 21/25 Sense off-target Xetrov107052389m.g
Chr8:10890521..10890545 21/25 Antisense off-target LOC116406899
Chr8:10890521..10890545 21/25 Sense off-target Xetrov107052389m.g
Chr8:10890537..10890561 21/25 Antisense off-target LOC116406899
Chr8:10890537..10890561 21/25 Sense off-target Xetrov107052389m.g
Chr8:10890553..10890577 21/25 Antisense off-target LOC116406899
Chr8:10890553..10890577 21/25 Sense off-target Xetrov107052389m.g
Chr8:10890587..10890611 21/25 Antisense off-target LOC116406899
Chr8:10890587..10890611 21/25 Sense off-target Xetrov107052389m.g
Chr8:570732..570756 21/25 Antisense off-target LOC116406888
Chr9:1704246..1704270 21/25 Antisense off-target LOC100496344
Chr9:214532..214556 21/25 Sense off-target mgrn1
Chr9:215500..215524 21/25 Sense off-target mgrn1
Chr9:215732..215756 21/25 Sense off-target mgrn1
Chr9:216196..216220 21/25 Sense off-target mgrn1
Chr9:620965..620989 21/25 Antisense off-target atp2a1
Chr9:620965..620989 21/25 Sense off-target Xetrov107059170m.g
Chr9:65099998..65100022 21/25 Antisense off-target hoxd3
Chr9:65100136..65100160 21/25 Antisense off-target hoxd3
Chr9:65100220..65100244 21/25 Antisense off-target hoxd3
Chr9:65100328..65100352 21/25 Antisense off-target hoxd3
Chr9:90441678..90441702 21/25 Sense off-target Xetrov107063380m.g
Chr9:90441678..90441702 21/25 Sense off-target LOC116407839
Chr9:90446326..90446350 21/25 Sense off-target Xetrov107063380m.g
Chr9:90446326..90446350 21/25 Sense off-target LOC116407839
Chr9:90447306..90447330 21/25 Sense off-target Xetrov107063380m.g
Chr9:90447306..90447330 21/25 Sense off-target LOC116407839
Chr9:90447420..90447444 21/25 Sense off-target Xetrov107063380m.g
Chr9:90447420..90447444 21/25 Sense off-target LOC116407839
Chr9:90447920..90447944 21/25 Sense off-target Xetrov107063380m.g
Chr9:90447920..90447944 21/25 Sense off-target LOC116407839
Chr9:90447998..90448022 21/25 Sense off-target Xetrov107063380m.g
Chr9:90447998..90448022 21/25 Sense off-target LOC116407839
Chr9:90448189..90448213 21/25 Sense off-target Xetrov107063380m.g
Chr9:90448189..90448213 21/25 Sense off-target LOC116407839
Chr9:90449483..90449507 21/25 Sense off-target Xetrov107063380m.g
Chr9:90449483..90449507 21/25 Sense off-target LOC116407839
Chr9:90471997..90472021 21/25 Sense off-target Xetrov107063380m.g
Chr9:90471997..90472021 21/25 Antisense off-target Xetrov107063383m.g
Chr9:90473089..90473113 21/25 Sense off-target Xetrov107063380m.g
Chr9:90473089..90473113 21/25 Antisense off-target Xetrov107063383m.g
Chr9:90473581..90473605 21/25 Sense off-target Xetrov107063380m.g
Chr9:90473581..90473605 21/25 Antisense off-target Xetrov107063383m.g
Chr9:90473661..90473685 21/25 Sense off-target Xetrov107063380m.g
Chr9:90473661..90473685 21/25 Antisense off-target Xetrov107063383m.g
Chr9:90473846..90473870 21/25 Sense off-target Xetrov107063380m.g
Chr9:90473846..90473870 21/25 Antisense off-target Xetrov107063383m.g
Chr9:90474520..90474544 21/25 Sense off-target Xetrov107063380m.g
Chr9:90474520..90474544 21/25 Antisense off-target Xetrov107063383m.g
Chr9:90475157..90475181 21/25 Sense off-target Xetrov107063380m.g
Chr9:90475157..90475181 21/25 Antisense off-target Xetrov107063383m.g
Chr10:34791772..34791796 22/25 unknown
Chr5:4535..4559 22/25 unknown
Chr1:178159814..178159838 21/25 unknown
Chr1:217138464..217138488 21/25 unknown
Chr10:10995167..10995191 21/25 unknown
Chr10:34791152..34791176 21/25 unknown
Chr10:34791368..34791392 21/25 unknown
Chr10:34791826..34791850 21/25 unknown
Chr10:6228049..6228073 21/25 unknown
Chr10:6228129..6228153 21/25 unknown
Chr10:6228161..6228185 21/25 unknown
Chr10:6228187..6228211 21/25 unknown
Chr10:6228223..6228247 21/25 unknown
Chr10:6228245..6228269 21/25 unknown
Chr2:151378679..151378703 21/25 unknown
Chr2:180110515..180110539 21/25 unknown
Chr2:180110735..180110759 21/25 unknown
Chr2:180111002..180111026 21/25 unknown
Chr2:25711064..25711088 21/25 unknown
Chr3:5806456..5806480 21/25 unknown
Chr3:5806532..5806556 21/25 unknown
Chr3:5806590..5806614 21/25 unknown
Chr3:5806612..5806636 21/25 unknown
Chr3:5806638..5806662 21/25 unknown
Chr3:5806660..5806684 21/25 unknown
Chr3:5806742..5806766 21/25 unknown
Chr3:5806878..5806902 21/25 unknown
Chr4:152944682..152944706 21/25 unknown
Chr4:152944970..152944994 21/25 unknown
Chr4:152945018..152945042 21/25 unknown
Chr4:152945416..152945440 21/25 unknown
Chr4:152945432..152945456 21/25 unknown
Chr4:152945480..152945504 21/25 unknown
Chr4:152945496..152945520 21/25 unknown
Chr5:162008072..162008096 21/25 unknown
Chr5:162008088..162008112 21/25 unknown
Chr5:162008116..162008140 21/25 unknown
Chr5:162008312..162008336 21/25 unknown
Chr5:4601..4625 21/25 unknown
Chr6:104146294..104146318 21/25 unknown
Chr6:104146470..104146494 21/25 unknown
Chr6:113567806..113567830 21/25 unknown
Chr6:113567830..113567854 21/25 unknown
Chr6:113567996..113568020 21/25 unknown
Chr6:113568084..113568108 21/25 unknown
Chr6:113568124..113568148 21/25 unknown
Chr6:113568216..113568240 21/25 unknown
Chr6:113568254..113568278 21/25 unknown
Chr6:113568294..113568318 21/25 unknown
Chr6:11584298..11584322 21/25 unknown
Chr6:120298117..120298141 21/25 unknown
Chr6:120299451..120299475 21/25 unknown
Chr6:120299483..120299507 21/25 unknown
Chr6:28265110..28265134 21/25 unknown
Chr6:28265294..28265318 21/25 unknown
Chr6:44084904..44084928 21/25 unknown
Chr6:44085080..44085104 21/25 unknown
Chr7:1329598..1329622 21/25 unknown
Chr7:2315647..2315671 21/25 unknown
Chr8:134702179..134702203 21/25 unknown
Chr8:3447128..3447152 21/25 unknown
Chr9:67437257..67437281 21/25 unknown
Chr9:67437529..67437553 21/25 unknown
Chr9:7952161..7952185 21/25 unknown
Chr9:7952231..7952255 21/25 unknown
Chr9:7952385..7952409 21/25 unknown
Chr9:7952401..7952425 21/25 unknown
Chr9:7952417..7952441 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers