Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311421

Morpholino Name: acbd6 MO1
Synonyms: TEgg003f20, Xtnovel48
Target mRNA: acbd6

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGCTGCTGACTCTCGCACTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 21/24
genomic

MO
5' CTAGTGCGAGAGTCAGCAGCCATG 3' |||||||||||||||||||||||| 3' GATCACGCTCTCAGTCGTCGGTAC 5' 5' TTAGTGCGAGGGACAGCAGCCATG 3' ||||||||| | ||||||||||| 3' GATCACGCTCTCAGTCGTCGGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4S:74449027..74449050 21/24 Antisense target acbd6.S
chr7S:11408809..11408832 22/24 Antisense off-target ctbp2.S
chr2L:102455758..102455781 20/24 Sense off-target LOC108708366 [provisional:msi2]
tropicalis 10.0 Chr4:101020364..101020387 24/24 Antisense target acbd6
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers